Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 4137366
End position: 4137392
Length: 27

DNA sequence
>NC_020376, from 4137366 to 4137392 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 GTTGTGGTAATTGTGGTAATTGTGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4137284-4137499	Sequence	H175_ch4200 - hypothetical protein (Protein is coded in complementary strand; from 4137499 to 4137284)