Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 4517648
End position: 4517674
Length: 27

DNA sequence
>NC_020376, from 4517648 to 4517674 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CCTGTTATTCCTGTTATTCCTGTTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4516964-4518028	Sequence	H175_ch4619 - BclA protein (Protein is coded in complementary strand; from 4518028 to 4516964)