Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 739383
End position: 739409
Length: 27

DNA sequence
>NC_020376, from 739383 to 739409 (27 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AGAACCTGCAAAACCTGCAAAACCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 738467-739756	Sequence	H175_ch0666 - Cell wall-binding protein