Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1522811
End position: 1522840
Length: 30

DNA sequence
>NC_020376, from 1522811 to 1522840 (30 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 GTTGTTGTTCTTGTTGCTGTTCTTGTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1522588-1525284	Sequence	H175_ch1494 - Multimodular transpeptidase-transglycosylase / Penicillin-binding protein 1A/1B (Protein is coded in complementary strand; from 1525284 to 1522588)