Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 379728
End position: 379757
Length: 30

DNA sequence
>NC_020376, from 379728 to 379757 (30 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AGAAAGCGAAAGTGAAAGCGAAAGTGAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 379301-379810	Sequence	H175_ch0333 - Spore coat protein B