Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2814765
End position: 2814800
Length: 36

DNA sequence
>NC_020376, from 2814765 to 2814800 (36 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CAATCCCAATTATAATCCCAATCACAATTCCGATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2814749-2814916	Sequence	H175_ch2826 - hypothetical protein (Protein is coded in complementary strand; from 2814916 to 2814749)