Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 3076616
End position: 3076651
Length: 36

DNA sequence
>NC_020376, from 3076616 to 3076651 (36 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CCCTGAAACCATCCCTGTAACAATACCTGCAACCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3076029-3076724	Sequence	H175_ch3107 - Membrane protein (Protein is coded in complementary strand; from 3076724 to 3076029)