Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 3811504
End position: 3811539
Length: 36

DNA sequence
>NC_020376, from 3811504 to 3811539 (36 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 GTTCTTCTTGTTGTTCTTTTTCTTTTTCTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3811074-3812021	Sequence	H175_ch3848 - Phage replication protein (Protein is coded in complementary strand; from 3812021 to 3811074)