Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2971449
End position: 2971490
Length: 42

DNA sequence
>NC_020376, from 2971449 to 2971490 (42 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 GCTTTTGCTATTTCTTTTGCTTTTGCTATTTCTTTTGCTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2970981-2972525	Sequence	H175_ch3003 - enterotoxin / cell-wall binding protein (Protein is coded in complementary strand; from 2972525 to 2970981)