Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 5100233
End position: 5100274
Length: 42

DNA sequence
>NC_020376, from 5100233 to 5100274 (42 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TGCGGATGCGGATGTGGATGCGGATGTGGATGCAGATGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5100138-5102582	Sequence	H175_ch5239 - 3'-to-5' exoribonuclease RNase R (Protein is coded in complementary strand; from 5102582 to 5100138)