Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1296568
End position: 1296612
Length: 45

DNA sequence
>NC_020376, from 1296568 to 1296612 (45 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTCAGCAGGCTTTTGCTCAGCTGGTTTTTGTTCAGCAGGTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1296179-1296976	Sequence	H175_ch1240 - Transporter (Protein is coded in complementary strand; from 1296976 to 1296179)