Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2611110
End position: 2611154
Length: 45

DNA sequence
>NC_020376, from 2611110 to 2611154 (45 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TCCACAAGTGGAGAATCCACATATGGAAAATCCACAAGTGGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2610824-2611558	Sequence	H175_ch2599 - DNA replication protein