Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 3755657
End position: 3755701
Length: 45

DNA sequence
>NC_020376, from 3755657 to 3755701 (45 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTGCTCCTCTTTCTTTGGTTCTTCTTTCTTTGGTTCCTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3755301-3756212	Sequence	H175_ch3785 - Transcriptional regulator (Protein is coded in complementary strand; from 3756212 to 3755301)