Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 441331
End position: 441375
Length: 45

DNA sequence
>NC_020376, from 441331 to 441375 (45 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CCAGAACCATTGCCACCAGAACCGTTGCCACCAGAACCGTTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 440878-441756	Sequence	H175_ch0384 - LPXTG-motif cell wall anchor domain protein (Protein is coded in complementary strand; from 441756 to 440878)