Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1231284
End position: 1231337
Length: 54

DNA sequence
>NC_020376, from 1231284 to 1231337 (54 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AGAGCAAGAACAGCCAGAACAGCCAGAACAGCCAGAACAGCCAGAACAGCAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1231034-1231588	Sequence	H175_ch1168 - Signal recognition particle receptor protein FtsY