Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1281011
End position: 1281064
Length: 54

DNA sequence
>NC_020376, from 1281011 to 1281064 (54 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AGAAGAACAGAAGAAAGCAGAAGAACAGAAGAAAGCAGAAGAACAAAAGAAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1280302-1281072	Sequence	H175_ch1225 - Hypothetical protein in cluster with SinR and SinI