Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2379989
End position: 2380042
Length: 54

DNA sequence
>NC_020376, from 2379989 to 2380042 (54 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CGACAGGTCCAACAGGTCCAACAGGTCCAACAGGTCCAACAGGTCCAACAGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2379515-2380843	Sequence	H175_ch2396 - Exosporium protein J