Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 4536093
End position: 4536146
Length: 54

DNA sequence
>NC_020376, from 4536093 to 4536146 (54 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 ATCTTGGTTGTCGTTTCCACCTTGGTTGTTATTTCCGCCTTGGTTGTCGTTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4534972-4537692	Sequence	H175_ch4640 - Cell surface protein IsdA, transfers heme from hemoglobin to apo-IsdC (Protein is coded in complementary strand; from 4537692 to 4534972)