Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2148948
End position: 2149007
Length: 60

DNA sequence
>NC_020376, from 2148948 to 2149007 (60 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AGGAACTGGAACAGGAGGAACTGGAACAGGAGGAACTGGAACAGGAGGAACTGGAACAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2148320-2151220	Sequence	H175_ch2155 - Putative secretion accessory protein EsaA/YueB