Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 979696
End position: 979755
Length: 60

DNA sequence
>NC_020376, from 979696 to 979755 (60 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CCTAAACAAGAAAATACTAAACAAGAACCTGTTAAACAAGAAAACACTAAGCAAGAGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 979415-979987	Sequence	H175_ch0905 - hypothetical protein