Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1023813
End position: 1023875
Length: 63

DNA sequence
>NC_020376, from 1023813 to 1023875 (63 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TGTTCGTAATTCTTCAGCTTGCATTTGTAGTTCTTCAGCTTGCGTTTGTAATTCTTCTGATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1022491-1025181	Sequence	H175_ch0955 - sensor histidine kinase/response regulator (Protein is coded in complementary strand; from 1025181 to 1022491)