Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1438760
End position: 1438822
Length: 63

DNA sequence
>NC_020376, from 1438760 to 1438822 (63 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 GAAGAAGAAAAGCGAAGAAAAGAAGAAGAAAAGAAAAGGCAAGAAGAAGAAAAGAAAAGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1436838-1438901	Sequence	H175_ch1400 - Multimodular transpeptidase-transglycosylase