Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 3228496
End position: 3228558
Length: 63

DNA sequence
>NC_020376, from 3228496 to 3228558 (63 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TCATCTTTTGGTTTTTGTACTTCTTCCTTAGGTTTTTGTACTTCTTCCTTAGGCTTTTGTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3227977-3229797	Sequence	H175_ch3259 - N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 3229797 to 3227977)