Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 4363777
End position: 4363839
Length: 63

DNA sequence
>NC_020376, from 4363777 to 4363839 (63 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTCTTCTTCAGCTTTTTTCTTTTCTTCCTCAGCCTTTAACTTCTCTTCTTCAGCTTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4363433-4364095	Sequence	H175_ch4463 - hypothetical protein (Protein is coded in complementary strand; from 4364095 to 4363433)