Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 1090747
End position: 1090818
Length: 72

DNA sequence
>NC_020376, from 1090747 to 1090818 (72 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 GAACACCGAATCCAGAAAAACCTGGAACACCAGATCCAGAAAAACCTGGAACACCGAATCCAGAAAAACC TG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1084489-1091052	Sequence	H175_ch1026 - hypothetical protein