Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2265669
End position: 2265740
Length: 72

DNA sequence
>NC_020376, from 2265669 to 2265740 (72 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 AAGAAGCAAGAAGAACAAAAGAAACTAGAAGAGCAAAAGAAACAAGAAGAAGAAAAGAAACAAAATGAAC AA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2263522-2266020	Sequence	H175_ch2281 - Multimodular transpeptidase-transglycosylase