Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2358870
End position: 2358941
Length: 72

DNA sequence
>NC_020376, from 2358870 to 2358941 (72 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 CCCGGTAGGTCCAGTGGAACCAGTAGGTCCAGTGGAACCAGTAGTTCCAGTGGAGCCGGTAGGTCCAGTA GC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2358551-2359387	Sequence	H175_ch2369 - DNA-directed RNA polymerase beta subunit