Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 2644864
End position: 2644935
Length: 72

DNA sequence
>NC_020376, from 2644864 to 2644935 (72 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 GGAGTAACGGGTCCAACAGGAGTAACGGGTCCAACAGGAGTAACGGGTCCAACAGGAGTAACGGGTCCAA CA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2644738-2645202	Sequence	H175_ch2643 - Queuosine Biosynthesis QueE Radical SAM (Protein is coded in complementary strand; from 2645202 to 2644738)