Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 3777715
End position: 3777786
Length: 72

DNA sequence
>NC_020376, from 3777715 to 3777786 (72 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TGTTGGGCCTGTTGGACCTGTTGGGCCTGTTGGACCTGTTGGACCTGTTGGACCTGTTGGACCTGTTGGA CC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3777047-3777901	Sequence	H175_ch3804 - Flagellar hook-length control protein FliK (Protein is coded in complementary strand; from 3777901 to 3777047)