Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 4899074
End position: 4899145
Length: 72

DNA sequence
>NC_020376, from 4899074 to 4899145 (72 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 GGTTCTTTCGGATCTTTCGGTTCTTTCGGTTCTTTCGGTTCTTTCGGTTCTTTCGGTTCTTTCGGATCTT CC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4898483-4908670	Sequence	H175_ch5017 - Cell surface protein (Protein is coded in complementary strand; from 4908670 to 4898483)