Sequence retrieval

Genome: Bacillus thuringiensis serovar thuringiensis str. IS5056
Start position: 848924
End position: 848995
Length: 72

DNA sequence
>NC_020376, from 848924 to 848995 (72 bp); Bacillus thuringiensis serovar thuringiensis str. IS5056 TTGAGCTTTAGCTGCTTCTTTAGCTTTGGCCGCTTCACGAGCTTCAGCTGCTTCTTGAGCCTTAGCCGCT TG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 848559-849947	Sequence	H175_ch0776 - enterotoxin / cell-wall binding protein (Protein is coded in complementary strand; from 849947 to 848559)