Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 1725524
End position: 1725559
Length: 36

DNA sequence
>NC_020800, from 1725524 to 1725559 (36 bp); Xanthomonas axonopodis Xac29-1 TCGCCTCCATCGCCTCCATCGCCTCCATCGCCTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1724597-1725751	Sequence	XAC29_07520 - hypothetical protein (Protein is coded in complementary strand; from 1725751 to 1724597)