Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 2281656
End position: 2281679
Length: 24

DNA sequence
>NC_020800, from 2281656 to 2281679 (24 bp); Xanthomonas axonopodis Xac29-1 TTGACCTTGACCTTGACCTTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2280261-2283134	Sequence	XAC29_09815 - diguanylate cyclase (Protein is coded in complementary strand; from 2283134 to 2280261)