Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 3048461
End position: 3048484
Length: 24

DNA sequence
>NC_020800, from 3048461 to 3048484 (24 bp); Xanthomonas axonopodis Xac29-1 TGCCGGTGCCGGTGCCGGTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3047550-3048551	Sequence	XAC29_13100 - GumN protein (Protein is coded in complementary strand; from 3048551 to 3047550)