Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 3117514
End position: 3117540
Length: 27

DNA sequence
>NC_020800, from 3117514 to 3117540 (27 bp); Xanthomonas axonopodis Xac29-1 GGCGGCGGTGGCGGCGGTGGCGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3116462-3117580	Sequence	XAC29_13445 - hypothetical protein
ORF. 3117504-3118256	Sequence	XAC29_13450 - hypothetical protein