Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 3370359
End position: 3370385
Length: 27

DNA sequence
>NC_020800, from 3370359 to 3370385 (27 bp); Xanthomonas axonopodis Xac29-1 ACCACCTCCACCACCTCCACCACCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3369681-3370457	Sequence	XAC29_14580 - hypothetical protein (Protein is coded in complementary strand; from 3370457 to 3369681)