Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 3457588
End position: 3457623
Length: 36

DNA sequence
>NC_020800, from 3457588 to 3457623 (36 bp); Xanthomonas axonopodis Xac29-1 ATTGCCATTGCCATTGCCATTGCCATTGCCATTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3457169-3458029	Sequence	XAC29_15000 - hypothetical protein (Protein is coded in complementary strand; from 3458029 to 3457169)