Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 3929216
End position: 3929243
Length: 28

DNA sequence
>NC_020800, from 3929216 to 3929243 (28 bp); Xanthomonas axonopodis Xac29-1 CGGGAATCGGGAATCGGGAATCGGGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3927352-3929328	Sequence	XAC29_16965 - bifunctional sulfate adenylyltransferase subunit 1/adenylylsulfate kinase protein (Protein is coded in complementary strand; from 3929328 to 3927352)