Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 397612
End position: 397638
Length: 27

DNA sequence
>NC_020800, from 397612 to 397638 (27 bp); Xanthomonas axonopodis Xac29-1 ACAGCGACGACAGCGACGACAGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 395682-397649	Sequence	XAC29_01695 - conditioned medium factor (density-sensing factor) (Protein is coded in complementary strand; from 397649 to 395682)