Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 4214658
End position: 4214685
Length: 28

DNA sequence
>NC_020800, from 4214658 to 4214685 (28 bp); Xanthomonas axonopodis Xac29-1 ATTCCCGATTCCCGATTCCCGATTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4213069-4217115	Sequence	XAC29_18070 - phosphoribosylformylglycinamidine synthase (Protein is coded in complementary strand; from 4217115 to 4213069)