Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 4502925
End position: 4502954
Length: 30

DNA sequence
>NC_020800, from 4502925 to 4502954 (30 bp); Xanthomonas axonopodis Xac29-1 GTCGGTGTCGGTGTCGGTGTCGGTGTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4502890-4503432	Sequence	XAC29_19420 - hypothetical protein (Protein is coded in complementary strand; from 4503432 to 4502890)