Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 594546
End position: 594573
Length: 28

DNA sequence
>NC_020800, from 594546 to 594573 (28 bp); Xanthomonas axonopodis Xac29-1 GCGAGCGGCGAGCGGCGAGCGGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 594470-594724	Sequence	XAC29_02580 - hypothetical protein (Protein is coded in complementary strand; from 594724 to 594470)