Sequence retrieval

Genome: Xanthomonas axonopodis Xac29-1
Start position: 95517
End position: 95552
Length: 36

DNA sequence
>NC_020800, from 95517 to 95552 (36 bp); Xanthomonas axonopodis Xac29-1 CATCTACATCTACATCTACATCTACATCTACATCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 94613-96094	Sequence	XAC29_00390 - hypothetical protein (Protein is coded in complementary strand; from 96094 to 94613)