Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 1028153
End position: 1028180
Length: 28

DNA sequence
>NC_020815, from 1028153 to 1028180 (28 bp); Xanthomonas citri subsp. citri Aw12879 GAATCGGGAATCGGGAATCGGGAATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1027224-1028153	Sequence	XCAW_00886 bmrU kinase related to diacylglycerol kinase