Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 123626
End position: 123695
Length: 70

DNA sequence
>NC_020815, from 123626 to 123695 (70 bp); Xanthomonas citri subsp. citri Aw12879 ACGCACAACGCACAACGCACAACGCACAACGCACAACGCACAACGCACAACGCACAACGCACAACGCACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 123064-123690	Sequence	XCAW_00096 - Hypothetical Protein (Protein is coded in complementary strand; from 123690 to 123064)