Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 1511651
End position: 1511677
Length: 27

DNA sequence
>NC_020815, from 1511651 to 1511677 (27 bp); Xanthomonas citri subsp. citri Aw12879 CGGGTCGCCCGGCTCGCCCGGGTTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1510455-1512530	Sequence	XCAW_01344 phuR Outer membrane hemin receptor (Protein is coded in complementary strand; from 1512530 to 1510455)