Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 1556076
End position: 1556099
Length: 24

DNA sequence
>NC_020815, from 1556076 to 1556099 (24 bp); Xanthomonas citri subsp. citri Aw12879 CGGCACCCGCACCGGCAACGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1556065-1556970	Sequence	XCAW_01384 ppiB Peptidyl-prolyl cis-trans isomerase (rotamase) - cyclophilin family (Protein is coded in complementary strand; from 1556970 to 1556065)