Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 1557699
End position: 1557722
Length: 24

DNA sequence
>NC_020815, from 1557699 to 1557722 (24 bp); Xanthomonas citri subsp. citri Aw12879 CATCGACATCGACATGGACAACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1557581-1558066	Sequence	XCAW_01386 - Hypothetical Protein (Protein is coded in complementary strand; from 1558066 to 1557581)