Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 1569285
End position: 1569312
Length: 28

DNA sequence
>NC_020815, from 1569285 to 1569312 (28 bp); Xanthomonas citri subsp. citri Aw12879 CCGATTCCCGAATCCCGAATCCCGATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1569111-1569980	Sequence	XCAW_01396 nadD Nicotinic acid mononucleotide adenylyltransferase