Sequence retrieval

Genome: Xanthomonas citri subsp. citri Aw12879
Start position: 1761294
End position: 1761317
Length: 24

DNA sequence
>NC_020815, from 1761294 to 1761317 (24 bp); Xanthomonas citri subsp. citri Aw12879 GCCGCCACCGCCACCGCCGCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1758637-1761372	Sequence	XCAW_01555 aprE Subtilisin-like serine protease (Protein is coded in complementary strand; from 1761372 to 1758637)